Efficient Nucleic Acid Extraction Using the OT-2 Automated Pipetting Platform

Application Overview Driven by ever-advancing technologies, modern molecular biology continues to achieve highly anticipated breakthroughs and developments, including larger studies, more powerful treatments, and entirely new research questions. However, although the technology of nucleic acid extraction is an important and inseparable experimental link for the advancement of molecular biology, researchers are still using long and cumbersome procedures from decades ago to perform nucleic acid extraction. Under such dilemma, automated solutions emerged as the times require. Modern automation realizes the efficient automatic operation of standardized processes by introducing machines and equipment with the advantages of stability and efficient operation. Automated nucleic acid extraction will modernize the old working methods of biological laboratories. In order to truly help scientific researchers achieve efficient R&D or production, automated systems need to meet or even exceed the performance of highly skilled technicians and provide high-quality samples for downstream workflows.

This study was designed to test the performance of the Opentrons OT-2 nucleic acid workstation as an efficient automated magnetic bead gene extraction tool. Several common templates used by researchers and clinicians were used in the study: human saliva, human buccal swabs, bacterial cultures, and RNA viruses. At the same time, mainstream reagent brands common in the industry were used. Performance is evaluated through yield, CV values, and qPCR data, and the experimental data is compared to the results of manual work performed by highly skilled technicians.

After research and testing, the OT-2 performed extremely well. Experimental variability for extraction using OT-2 is reduced while improving reproducibility, and provides similar yields at lower costs and faster turnaround times. Importantly, these performance improvements and cost savings scale as throughput increases. Therefore, this test demonstrates that the use of OT-2 for nucleic acid extraction automation enables efficient automation of experimental workflows, allowing automated nucleic acid extraction to meet the high-performance standards of high-end molecular biology.

Study Materials and Methods Human Saliva: Fresh saliva was collected from anonymous donors and stored in 15 mL conical tubes until use.

Oral swabs: Use 20 mm break point (Zymo@) oral collection swabs to sample anonymous volunteers, store them in 1 mL Zymo DNA/RNA protection solution, and store and transport them at room temperature.

Bacterial culture: Use One shot°TOP10 to prepare competent E. coli (Thermo Fisher Scientific*) and culture it in the lysate overnight at 37°C with shaking at 225 rpm. Before use, each sample was centrifuged at 2000 rpm for 1.5 minutes. The supernatant was removed and the pellet was resuspended in an equal volume of cold phosphate buffer. In addition, for Lactobacillus samples, approximately 1×107 copies/μL of Lactobacillus plantarum (ATCC°8014MINIPACKTM) was used per sample.

Viruses: Due to the onset of the COVID-19 global pandemic in March 2020 (1), the viral RNA kit used synthetic SARS-COV-2 RNA Control 2 (Twist Biosciences) at 10 copies/μL per sample.

Internal control: Synthetic nasal matrix (SNM) was used and created as described by Panpradist, Nuttada et al. (2). The formula of SNM is: 110 mM NaCl, 1% w/v mucin from porcine gastric type I (Sigma M2378-100G) and 10 μg/mL w/v human genomic DNA (Coriell NA12878), mixed volume is TE/SNM 90%. Use 50 pg/μL of SNM for each virus sample.

Kits: DNA, RNA and viral RNA extraction kits from different brands were selected in this study (see Table 1). A total of 13 kits from 7 reagent brands were tested.

Extraction: Each DNA and RNA extraction reagent and template was manually tested prior to automated testing to obtain baseline concentrations for manual testing. Each template was tested in 7 replicates per reagent with 1 negative control sample. In this study, automated nucleic acid extraction was performed on the Opentrons platform. For DNA and RNA extraction reagents, seven extractions were performed per sample. For the viral RNA extraction kit, 22 samples with identical SARS-CoV-2 and SNM templates were included. A negative control sample (nuclease-free H2O) is included in each OT-2 run. The OT-2 equipment is equipped with a GEN2 magnetic bead purification module, a p300 multi-channel pipette and an optional GEN2 temperature control module. For RNA experiments, in order to ensure better experimental results, it is recommended to equip the temperature control module. Depending on the kit, approximately 14 boxes of 300 μL tips, 1 NEST single-well reservoir, 1 NEST 2 mL deep-well plate, 2 NEST 12-well reservoirs and 1 PCR well plate are required.

Primers: Primers and probes from the Centers for Disease Control and Prevention (CDC):

2019-nCoV_N1-F(GACCCCAAAATCAGCGAAAT)2019-nCoV_N1-R (TCTGGTTACTGCCAGTTGAATCTG)2019-nCoV_N1-P(FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1)2019-nCoV_N2-F(TTACAAACATTGGCCGCAAA)2019-nCoV_N2- R(GCGCGACATTCCGAAGAA)2019-nCoV_N2-P(FAMACAATTTGCCCCCAGCGCTTCAG-BHQ1)RP-F(AGATTTGGACCTGCGAGCG),RP-R(GAGCGGCTGTCTCCACAAGT)RP-P (FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1)

CDC primers and probes were ordered from Integrated DNA Technologies, also known as IDT (2019-nCoV CDC EUA kit). N1, N2, and RNase P are premixed at concentrations recommended by the CDC. 16s primer: Forward (CCTATAAGACTGGGATAACTTCGGG)Reverse (CTTTGAGTTTCAACCTTGCGGTCG) 16s primer was ordered from IDT, resuspended in IDTE 1XTE solution pH: 8.0 (DT), and diluted to a working concentration of 10uM.

Quantitative measurements: The concentration of DNA and RNA samples can be quantitatively measured using the Qubit 4.0 FluorometerM (Thermo Fisher).

Additionally, all samples were quantified by qPCR on a PCR max ECO48 real-time PCR system. RNA samples were tested using the Luna° Universal Probe One-Step RT-qPCR Kit (NEB), and concentrations were tested by Lista, Maria Jose et al. (3). Carry out the following procedure: perform reverse transcription at 55 °C for 10 min. Initial denaturation was performed at 95°C for 1 minute, followed by 50 cycles of denaturation at 95°C for 10 seconds and annealing at 60°C for 30 seconds. DNA samples were tested using Luna Universal qPCR Master Mix (NEB) at concentrations recommended by the manufacturer. The following program was used: initial denaturation was performed at 95 °C for 60 s, followed by denaturation and extension at 95 °C for 15 s and 60 °C for 30 s, respectively, for 40 cycles.

The experimental results were measured by qPCR and fluorometer analysis. The number of nucleic acids extracted by OT-2 was close, and the consistency of the nucleic acid samples was higher.

OT-2 has been performance tested to EUA standards and can be used with a variety of qPCR nuclear extraction kits.

Human saliva and Lactobacillus plantarum bacterial cultures were processed using nine commonly used extraction kits, and qPCR analysis was performed using two common qPCR targets: RNase P for saliva samples and 16s for bacterial samples. E. coli cultures were processed using six kits and analyzed using fluorescence analysis.

Yield was assessed by cycle threshold (Ct) in qPCR and ng/μL obtained in a fluorometer. Consistency was assessed by the coefficient of variation (CV) of Ct values.

Ct values ​​reflect the number of replication cycles required for a sample to cross a threshold above the background signal, so they convey a reciprocal measure of quantity. For these objectives, a Ct value of 25-35 is more reliable in this type of sample.

As verified by all extraction kits, nucleic acid extraction and purification using the OT-2 automated system resulted in Ct values ​​with lower CV and comparable yields (see Figure 1 and Table 2). Skilled technicians and OT-2s return average Ct values ​​of 25-35.

The CV value of manual processing is 1.41-4.8, and the CV value of OT-2 is 1.2-2.6. Skilled technicians and OT-2 provided comparable and consistent yields of 24-26 ng/μL. These results demonstrate that OT-2 is capable of delivering high yields while improving consistency and reproducibility.

In tests related to the new coronavirus, qPCR was performed using synthetic SARS-CoV-2 samples and seven commonly used extraction kits. We used human genomic DNA in SNM as an internal control, CDC's SARS-CoV-2N1 and N2 primers for quantitative analysis, and CDC's RP primers as a positive control.

This test was designed to evaluate the performance of COVID-19 qPCR analysis on the OT-2 using different extraction kits. By using synthetic SARS-CoV-2 samples as well as internal controls and positive controls, the accuracy and reliability of OT-2 in detecting viral genomes can be judged.

Evaluation of qPCR performance is based on PCR assay Emergency Use Authorization (EUA) standards. To meet EUA criteria, a test must achieve 95% amplification efficiency, that is, in qPCR, 95% of samples must produce detectable N1 and N2 signals.

In this performance evaluation, we also evaluated qPCR Ct values. For these targets, the standard Ct value should be between 30-40 in this type of sample.

Based on the results in Table 3, OT-2 passed EUA criteria on nearly all kits. Except for two kits where the lysis buffer was too viscous and hampered the extraction process, only 91% of the test results were acceptable. Moreover, for all tested reagents, the sample results achieved the standard Ct value of 31-39. These results demonstrate that the OT-2 system can be used with various brands of reagents and meets clinical standards.

To test the throughput and speed of the OT-2 system, we used 13 popular kits for RNA and DNA extraction, covering various lengths. To fully evaluate the speed at different throughputs, batches of 8, 24, 48, and 96 samples were tested. Experimental results are measured as the time required from raw sample to purified nucleic acid.

Among these extraction reagent protocols, the OT-2 system delivers fast extraction results across a variety of kits and lengths. In the shortest protocol, processing of 8 samples took only 25 minutes, and in the longest protocol, processing of 96 samples took less than 5 hours (Figure 2). For eight samples, the average processing time for OT-2 across 13 kits was 52 minutes. With 96 samples, the average processing time for OT-2 across 13 kits was 2 hours and 45 minutes. These results demonstrate that the OT-2 system can combine its high performance with high throughput to significantly improve extraction workflows.

Research Thoughts The OT-2 Nucleic Acid Extraction Workstation provides high-quality RNA and DNA samples from organic and synthetic raw templates. Through qPCR and fluorescence testing, it was found that the automated system produced output comparable to manual results performed by highly skilled operators and exceeded the performance of manual operations in terms of experimental reproducibility and accuracy. Studies have shown that OT-2 successfully met the performance requirements to meet Emergency Use Authorization (EUA) standard levels, with a success rate of qPCR signal detection exceeding 95%. Time tests showed that the OT-2 processed 8 samples in less than 1 hour and 96 samples in less than 3 hours, which is an average for kits with different protocol lengths. In fact, using the fastest kit, the OT-2 takes only 25 minutes to process 8 samples and 1.5 hours to process 96 samples.

Application Summary ● For medium-throughput laboratories, the time saved alone is enough to make the OT-2 pay for itself in less than 6 months.

●OT-2 can save 3.5 hours of manual operation time by processing 24 sample extractions at a time. Higher throughput results in better accuracy, reduced variability and improved repeatability compared to manual operations.

●This high performance enables better quality control and reduces variability in downstream data. Additionally, eliminating tedious manual procedures reduces errors and reduces the cost of repeating procedures using expensive reagents.

These tests were performed on multiple samples of clinical and laboratory significance and on a variety of different extraction kits. The flexibility of the OT-2 allows it to be adapted to a variety of protocols, reagents and sample types to consistently deliver superior results.